Corresponding author: Adam Petrusek (
Academic editor: M. Uliano-Silva
Crayfish of North American origin are amongst the most prominent high-impact invasive invertebrates in European freshwaters. They contribute to the decline of European native crayfish species by spreading the pathogen causing crayfish plague, the oomycete
Rusch JC, Mojžišová M, Strand DA, Svobodová J, Vrålstad T, Petrusek A (2020) Simultaneous detection of native and invasive crayfish and
Environmental DNA (hereafter
During the past decade, different concepts of
One of the pathogens for which monitoring methods based on
American crayfish species, such as the spiny cheek crayfish
The marbled crayfish,
When non-indigenous crayfish are present, the only conceivable option to eradicate crayfish plague is by treating the entire waterbody with pesticides such as Betamax-VET (
Recent research has focused on developing
In this study we demonstrate the applicability of
Czech waters host three documented North American crayfish species.
Native and non-native crayfish populations can be found in a wide range of diverse habitats in Czechia: large and smaller rivers and streams as well as artificial still waters including fishponds, flooded quarries and reservoir lakes. There is a wealth of documented data on existing crayfish populations in lentic and lotic waterbodies in the country (
The goal of the study presented here is two-fold: firstly, to validate the specificity of presumably species-specific
Crayfish species searched for by means of
A full range of all relevant habitats for Central and Western Europe was covered, including large rivers and small streams, a thermal stream, natural lakes and man-made reservoirs, flooded quarries and fishponds (in total 32 localities; Suppl. material
For comparison with
Water samples at Czech locations 1 to 28 were obtained according to
For the samples obtained at locations 29 to 32 (Berlin and Budapest) the same filters (47 mm AP25 Millipore, 2 μm pore size) were used. However, the filters were placed into filter cups (Nalgene Analytical Test Filter Funnel, 145-0045; Thermo Fisher Scientific, Waltham, USA) after removal of the original filter provided by the manufacturer. Pumping was carried out by attaching the provided filter-cup adapter to a ¾ inch garden water hose and a drill-operated pump (product code 1490-20; Gardena, Ulm, Germany) (Fig.
Drill-powered sampling equipment. The low-cost sampling equipment used in this study consisting of a drill-powered pump, single use forceps, filter cups and glass fibre filters. The pump depicted in the bottom right corner is one of many alternative models to the one used in this study.
Filters from locations 1 to 28 were submerged in 4 ml of cetyl trimethyl ammonium bromide (
To prevent contamination of filters and accidental spreading of crayfish plague, a strict disinfection protocol was followed at each location. After filtering, all the equipment was submerged in, and filled with, a 10% chlorine bleach solution for a minimum of 15 minutes to break down any vital pathogen spores and residual
DNA isolation from the filters was performed according to the
Molecular
Due to the absence of any published assay for
High specificity of the primers–probe combination was first ensured by checking the variation of the potential primer and probe sites against
New assays, differing from those published in
For
Both newly-developed assays for
The final protocol used for
For all species-specific crayfish assays, we followed recommendations for defining the limit of detection (
In order to detect
All
As described above, each filter was divided into two technical replicates/subsamples. Both subsamples were analysed as 2x undiluted and 2x 10-fold diluted replicates, in total 4
The presence or absence of
Primers and probes used in the present study. The probes used are TaqMan
|
|
|
|
|
|
ITS | forward | AAGGCTTGTGCTGGGATGTT |
|
reverse | CTTCTTGCGAAACCTTCTGCTA |
|
||
probe | FAM-TTCGGGACGACCC-MGBNFQ |
|
||
|
|
forward | CCCCTTTRGCATCAGCTATTG | current study |
reverse | CGAAGATACACCTGCCAAGTGT | current study | ||
probe | FAM-CTCATGCAGGCGCAT-MGBFNQ | current study | ||
|
|
forward | GAGTGGGTACTGGATGAACTG | current study |
reverse | GAAGAAACACCCGCTAAATGAAG | current study | ||
probe | VIC-CAGCGGCTATTGCT-MGBFNQ | current study | ||
|
|
forward | CCTCCTCTCGCTTCTGCAAT |
|
reverse | AACCCCTGCTAAATGCAACG |
|
||
probe | FAM-CTCATGCAGGGGCATCAGTGG-MGBFNQ |
|
||
|
|
forward | ACGGGCAGCTGGTATAACTATG | current study |
reverse | TCTCCTCCACCAGCAGGATC | current study | ||
probe | FAM-CCGCTATTTGTTTGGTCAGTA-MGBNFQ | current study |
We successfully developed new assays for
Ensuing specificity testing against the collection of all DNA isolates (Suppl. material
For all crayfish assays,
We detected
Map of Czechia with results of the
From the total of 32 surveyed locations,
Results of the
No. | Locations | Habitat | Volume (in l) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
Prevalence | Max. agent level | ||||
1 | Vltava in Prague | River | 4 | – | – | – | – | 2 | 88% (15/17) | A4 | |
2 | Vltava (Vrané) | Reservoir | 2.2 | – | – | – | – | – | n/a | ||
3 | Kněžák Pond | Fishpond | 1.35 | – | – | – | – | – | n/a | ||
4 | Smečno | Urban pond | 1.9 | – | – | 1 | – | – | n/a | ||
5 | Barbora | Flooded mine | 10 | – | – | 2 | – | – |
|
0% (0/22) | (3 x A1) |
6 | Osecký Pond | Fishpond | 0.7 | – | – | – | – | – | n/a | ||
7 | Bouřlivec (Všechlapy) | Reservoir | 2.8 | 1 | – | 2 | – | – | ns | n/a | |
8 | Liběchovka | Stream | 1.5 | 2 | – | – | – | – | n/a | ||
9 | Pšovka (above Harasov) | Stream | 4.4 | 2 | – | – | – | – |
|
n/a | |
10 | Pšovka (Harasov) | Pond out | 10 | 1 | – | 2 | – | – |
|
20% (3/15) | A2 |
11 | Elbe | River | 3.8 | – | – | 2 | – | – |
|
35% (6/17) | A4 |
12 | Malše in České Budějovice | River | 1.85 | – | – | – | – | – | n/a | ||
13 | Malše (border with Austria) | Stream | 10 | – | 2 | – | – | 2 |
|
80% (16/20) | A3 |
14 | Zlatá stoka | Channel | 1.6 | – | – | 2 | – | 1 | 12.5% (1/8) | A3 | |
15 | Dračice | Stream | 1.2 | – | 2 | – | – | 2 |
|
100% (20/20) | A5 |
16 | Oslava (upstream) | Stream | 2.3 | 2 | 2 | – | – | – |
|
0% (0/23) | A0 |
17 | Balinka (upstream) | Stream | 4 | 2 | – | – | – | – |
|
n/a | |
18 | Oslava (confluence) | Small river | 10 | – | 2 | – | – | – |
|
n/a | |
19 | Balinka (confluence) | Stream | 4.1 | – | 2 | – | – | – | n/a | ||
20 | Žďárka | Stream | 5.1 | – | 2 | – | – | – |
|
0% (0/28) | A0 |
21 | Ochozský Brook | Stream | 0.85 | 2 | – | – | – | – |
|
n/a | |
22 | Staviště | Stream | 4.4 | – | 2 | – | – | – |
|
0% (0/18) | A0 |
23 | Kouba | Stream | 3 | – | 2 | – | – | – |
|
n/a | |
24 | Starý Klíčov – Lomeček | Quarry | 10 | – | – | 2 | – | – | ns | n/a | |
25 | Mže (Hracholusky) | Reservoir | 3.2 | – | – | 2 | – | – |
|
29% (2/10) | A3 |
26 | Kojetice | Quarry | 10 | – | – | 2 | – | – |
|
70% (14/20) | A2 |
27 | Prague–Prosek (park) | Urban pond | 10 | – | – | – | – | – | n/a | ||
28 | Rokytka | Stream | 2 | – | – | 2 | – | – | n/a | ||
29 | Krumme Lanke | Lake | 10 | – | – | – | – | – | ns | n/a | |
30 | Hundekehlesee | Lake | 10 | – | – | 2 | 1 | 1 | ns | n/a | |
31 | Tributary of Barát | Thermal stream | 10 | – | – | 2 | 2 | 2 | 85% (17/20) | A3 | |
32 | Barát Brook | Stream | 10 | – | – | 2 | 2 | 2 | n/a |
Non-native
Environmental DNA of non-native
In 24 subsamples (i.e. technical replicates),
This study explores the use of the
One of the potential pitfalls of
The cross-amplification of non-target species at high Ct levels, close to cut-off of both assays for
However, for management purposes in Europe, even the non-specific amplification of
An increasing number of studies, including the present one, demonstrate that the
For conservation purposes, for example when determining the suitability of an unpopulated habitat as an ark site, the critical information is nevertheless the presence or absence of the crayfish plague pathogen and any potential vectors thereof. For this purpose,
In this study, we failed to detect
Dilution of the
A useful tool to help determine the number of samples required for maximising detection probability could be occupancy modelling.
In the screening of crayfish habitats, we successfully managed to detect
The
We never detected
The observed co-occurrence of
The co-occurrence of
The use of
For both approaches, sampling strategies are of great importance for the quality and outcome regarding results. The choice of sample method, filter and volume might be of vital importance for maximising the detection probability of rare targets (
The cost of the sampling equipment, as used for example in
Compared to the traditional methods used to determine presence or absence of crayfish which consist of either manual searching or trapping, this method requires less time in the field at each sampling site and it allows for sampling at locations unsuitable for traditional monitoring. For example, some of the sampling points visited by us were inaccessible for manual searching crayfish and would have required trapping or scuba diving, neither of which was possible during the fieldwork for this study. The
The
It is particularly the positive data on the presence of crayfish and crayfish plague that yield valuable information, while negative results have to be interpreted with great caution. The latter should preferably be followed up with analyses of more samples collected in suitable periods, taking into account the time of year, temperature, water flow and the biology of the target species. This is of paramount importance if the absence of a specific species needs to be unambiguously established.
Including further assays of other crayfish species native to Central Europe, such as the stone crayfish, into this already broad panel will enable relevant stakeholders and authorities to use this method as a routine monitoring tool for all relevant crayfish species or in preparation of restocking operations.
This work was financially supported from several sources: 1) J.C. Rusch’ PhD project “Environmental DNA (
We thank Agata Mrugała for support in Berlin, Antonín Kouba for collecting water samples in Budapest, Jiří Patoka for providing reference aquarium samples, Elin Rolén for the help with
Table S1
details on localities
Detailed information about the
Table S2
species list
List of crayfish species used for in-vitro testing of the assay specificity.
Table S3
data for methods
Standard dilutions from crayfish genomic DNA.
Table S4
detailed results
Overview of the